Human cytomegalovirus control in allogeneic stem cell transplant recipients in the letermovir era - emerging humoral and cellular players

Oct 3, 2026

Supplementary Methods detail how human cytomegalovirus (HCMV) was monitored and how immune responses were quantified in allogeneic stem cell transplant recipients in the letermovir era. Viral load was measured from EDTA plasma by a clinically validated real-time PCR using specified primers, probe, and a plasmid positive control. HCMV-specific IgG/IgM were assessed with ARCHITECT CMV assays including automatic and manual dilutions. Flow cytometry protocols describe γδ T-, B-, and NK-cell phenotyping and HCMV-specific memory B-cell identification using biotinylated HCMV glycoprotein probes.

LanguageEnglish

CategoryResearch & Report

FormatPDF

Pages14

Reading Time35 min

AccessFree to download

Supplementary Methods

HCMV viral load measurements

HCMV-specific IgG and IgM measurements

Flow cytometry

ARTICLE-Cell Therapy & Immunotherapy Human cytomegalovirus control in allogeneic stem cell transplant recipients in the letermovir era – emerging humoral and cellular players Chris D. Lauruschkat,1 Hannah Görge,1 Kerstin Knie,2 Benedikt Weißbrich,2 Lars Dölken,2,3 Carolin Köchel,1 Nina Imhof,1 Magdalena Huber,4 Hartmut Hengel,4 Hermann Einsele,1,5 Sebastian Wurster6 and Sabrina Kraus1,5 1 Department of Internal Medicine II, University Hospital of Wuerzburg, Wuerzburg, Germany; 2 Institute for Virology and Immunobiology, University of Wuerzburg, Wuerzburg, Germany; 3 Institute of Virology, Hannover Medical School, Hannover, Germany; 4 Institute of Virology, Medical Center and Faculty of Medicine, University of Freiburg, Freiburg, Germany; 5 Bavarian Cancer Research Center (BZKF), Wuerzburg, Germany and 6 Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, TX, USA Correspondence: S. Kraus [Kraus_S3@ukw.de](Kraus_S3@ukw.de) C. D. Lauruschkat [Lauruschka_C@ukw.de](Lauruschka_C@ukw.de) Received: May 16, 2025. Accepted: November 11, 2025. Early view: November 27, 2025. [https://doi.org/10.3324/haematol.2025.288237](https://doi.org/10.3324/haematol.2025.288237) ©2026 Ferrata Storti Foundation Published under a CC BY-NC license HCMV control in allogeneic stem cell transplant recipients in the letermovir era-emerging humoral and cellular players Authors: Chris David Lauruschkat 1,\#, Hannah Görge 1, Kerstin Knies2, Benedikt Weißbrich2, Lars Dölken2,3, Carolin Köchel 1, Nina Imhof1, Magdalena Huber4, Hartmut Hengel4, Hermann Einsele 1,5, Sebastian Wurster6 and Sabrina Kraus 1,5\#,$ Affiliations: 1 Department of Internal Medicine II, University Hospital ofWuerzburg, Wuerzburg, Germany. 2 Institute for Virology and Immunobiology, University ofWuerzburg, Wuerzburg, Germany. 3 Institute of Virology, Hannover Medical School, Hannover, Germany. 4 Institute of Virology, Medical Center and Faculty of Medicine, University of Freiburg, Freiburg, Germany. 5 Bavarian Cancer Research Centre (BZKF), Wuerzburg, Germany 6 Department of Infectious Diseases, Infection Control and Employee Health, The University of Texas MD Anderson Cancer Center, Houston, USA. $ Requests for materials should be addressed to Sabrina Kraus ([Kraus_S3@ukw.de](Kraus_S3@ukw.de)) \# Co-corresponding authors: Sabrina Kraus and Chris D. Lauruschkat Department of Internal Medicine II University Hospital ofWuerzburg Oberduerrbacherstraße 6, 97080 Wuerzburg, Germany [Kraus_S3@ukw.de](Kraus_S3@ukw.de / Lauruschka_C@ukw.de)[ / ](Kraus_S3@ukw.de / Lauruschka_C@ukw.de)[Lauruschka_C@ukw.de](Kraus_S3@ukw.de / Lauruschka_C@ukw.de) Supplementary Methods HCMV viral load measurements HCMV DNA was quantified from EDTA plasma samples using a clinically validated real-time PCR assay, performed by the Institute of Virology at the University of Wuerzburg as part of routine diagnostics. The following primers and probe were used: CMV31 (AAgCggCCTCTgATAACCAAg), CMV32 (gAgCAgACTCTCAgAggATCgg), and CMV-TM46FAM (catgcagatctcctcaatgcggcg) . ApCMV8 plasmid cloned into the pCR2.1-TOPO vector served as the positive control. PCR amplification was carried out on an ABI 7500 Real-Time PCR System (Life Technologies) . HCMV-specific IgG and IgM measurements Serum HCMV-specific IgM and IgG levels were measured using clinically validated ARCHITECT CMV assays (Abbott, Ireland) on the ARCHITECT i2000SR system, performed by the Institute of Virology at the University of Wuerzburg. IgG samples exceeding the upper detection limit of 250 AU were automatically diluted 1:10 by the instrument and reanalyzed. In rare cases where this dilution was insufficient to bring values within range, a 1:100 dilution was prepared manually and subsequently analyzed on the same system. Flow cytometry After thawing, global γδ T-, B-, and NK-cell phenotypes were analyzed, and HCMV

FAQs

How was HCMV viral load quantified in the study?

HCMV DNA was measured from EDTA plasma using a clinically validated real-time PCR assay with specified primers and probe, including a cloned plasmid positive control.

Which method was used to measure HCMV-specific IgG and IgM?

HCMV-specific IgG and IgM were measured with clinically validated ARCHITECT CMV assays on the ARCHITECT i2000SR system, with automatic dilution for high IgG values and manual dilution when needed.

How were immune cell subsets analyzed by flow cytometry?

After thawing, global γδ T-, B-, and NK-cell phenotypes were assessed, and HCMV-specific B cells were quantified using stained PBMCs with specified antibody panels and viability dye.

Oct 3, 2026

Upload by Maya Linwood