[{"data":1,"prerenderedAt":-1},["ShallowReactive",2],{"detail-sidebar-cat-1-en-105":3,"doc-seo-195414-105":53,"doc-detail-195414-en":126},{"code":4,"msg":5,"data":6},0,"success",[7,14,19,24,29,34,39,44,49],{"id":8,"doc_module":9,"doc_module_name":10,"category_name":11,"show_sort_weight":12,"slug":13},11,1,"Template","Presentations",90,"presentations",{"id":15,"doc_module":9,"doc_module_name":10,"category_name":16,"show_sort_weight":17,"slug":18},12,"Resumes",80,"resumes",{"id":20,"doc_module":9,"doc_module_name":10,"category_name":21,"show_sort_weight":22,"slug":23},14,"Invoices",70,"invoices",{"id":25,"doc_module":9,"doc_module_name":10,"category_name":26,"show_sort_weight":27,"slug":28},15,"Posters",60,"posters",{"id":30,"doc_module":9,"doc_module_name":10,"category_name":31,"show_sort_weight":32,"slug":33},16,"Social Media",50,"social-media",{"id":35,"doc_module":9,"doc_module_name":10,"category_name":36,"show_sort_weight":37,"slug":38},17,"Forms",40,"forms",{"id":40,"doc_module":9,"doc_module_name":10,"category_name":41,"show_sort_weight":42,"slug":43},18,"Letters",30,"letters",{"id":45,"doc_module":9,"doc_module_name":10,"category_name":46,"show_sort_weight":47,"slug":48},21,"Paper Templates",5,"papers-templates",{"id":50,"doc_module":9,"doc_module_name":10,"category_name":51,"show_sort_weight":4,"slug":52},158,"General","general-158",{"code":4,"msg":54,"data":55},"ok",{"site_id":56,"language":57,"slug":58,"title":59,"keywords":60,"description":61,"schema_data":62,"social_meta":119,"head_meta":121,"extra_data":123,"updated_unix":125},105,"en","rickettsia","Rickettsia","","Data tables summarize tick-associated molecular targets and sequencing outcomes, including primer sets for 16S NGS profiling and Rickettsia- and other bacterial-specific PCR assays. Results report read counts, pre-processing and processed sequence numbers, ZOTU counts, and controls for NTCs and internal controls. Additional tables list tick species with sample totals and specify dominant ZOTUs with GenBank identifiers, alongside sequence composition statistics and variability ranges.",{"@graph":63,"@context":118},[64,80,101],{"@type":65,"itemListElement":66},"BreadcrumbList",[67,71,74,77],{"item":68,"name":69,"@type":70,"position":9},"https://docshare.wps.com","Home","ListItem",{"item":72,"name":10,"@type":70,"position":73},"https://docshare.wps.com/template/",2,{"item":75,"name":51,"@type":70,"position":76},"https://docshare.wps.com/template/general/",3,{"item":78,"name":59,"@type":70,"position":79},"https://docshare.wps.com/template/rickettsia/195414/",4,{"url":78,"name":59,"@type":81,"image":82,"author":87,"headline":59,"publisher":90,"fileFormat":93,"inLanguage":57,"description":61,"dateModified":94,"datePublished":95,"encodingFormat":93,"isAccessibleForFree":96,"interactionStatistic":97},"DigitalDocument",{"url":83,"@type":84,"width":85,"height":86},"https://docshare.wps.com/thumbnails/rickettsia/195414.png","ImageObject",442,249,{"name":88,"@type":89},"Ethan Miller","Person",{"url":68,"name":91,"@type":92},"DocShare","Organization","application/pdf","2026-09-27","2026-09-03",true,{"@type":98,"interactionType":99,"userInteractionCount":79},"InteractionCounter",{"@type":100},"ViewAction",{"@type":102,"mainEntity":103},"FAQPage",[104,110,114],{"name":105,"@type":106,"acceptedAnswer":107},"Which molecular targets are included for bacterial detection in the document?","Question",{"text":108,"@type":109},"The document lists targets such as 16S (bacteria V1–2), Rickettsia-specific markers (17 kDa, gltA, ompA, ompB), and other bacterial taxa using designated primers.","Answer",{"name":111,"@type":106,"acceptedAnswer":112},"How are sequencing results summarized across samples?",{"text":113,"@type":109},"Sequencing outcomes are presented as raw (unprocessed) reads, pre-processed reads, processed 16S sequences, and processed Rickettsia-specific sequences, with averages, SD, min/max values, and total counts.",{"name":115,"@type":106,"acceptedAnswer":116},"How does the document report dominant sequence variants for tick species?",{"text":117,"@type":109},"For selected tick species, it reports dominant ZOTUs with GenBank IDs, average sequence composition percentages with SD, and the range of composition across samples.","https://schema.org",{"og:url":78,"og:type":120,"og:title":59,"og:site_name":91,"og:description":61},"article",{"robots":122,"canonical":78},"index,follow",{"doc_id":124,"site_id":56},195414,1788448270,{"code":4,"msg":5,"data":127},{"doc_id":124,"user_id":128,"nickname":88,"user_avatar":129,"doc_module":9,"category_id":50,"category_name":51,"doc_title":59,"doc_description":61,"doc_content":130,"file_id":131,"file_url":132,"file_type":133,"file_size":134,"view_count":79,"is_deleted":4,"is_public":9,"is_downloadable":9,"audit_status":9,"page_count":135,"language":136,"language_code":57,"site_id":56,"html_lang":57,"table_of_contents":60,"faqs":137,"seo_title":138,"seo_description":61,"update_tm":125,"read_time":139},687207017582,"https://ap-avatar.wpscdn.com/davatar_994ba38a5ba835b3df7d355c54d3ed8d","| Tick species | Common name | Dogs |  | Cats |  | Horses |  | Total S no. | Total S and R no. |\n| --- | --- | --- | --- | --- | --- | --- | --- | --- | --- |\n|  |  | Sa no. | Rb no. | S no. | R no. | S no. | R no. |  |  |\n| Amblyomma triguttatum triguttatum | Ornate kangaroo tick | 5 | 0 | 0 | 0 | 12 | 0 | 17 | 17 |\n| Haemaphysalis bancrofti | Wallaby tick | 1 | 0 | 1 | 0 | 2 | 0 | 4 | 4 |\n| Haemaphysalis lagostrophia | – | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 1 |\n| Haemaphysalis longicornis | Bush tick or Asian longhorned tick | 46 | 0 | 0 | 0 | 1 | 0 | 47 | 47 |\n| Haemaphysalis sp. genotype 1b | – | 0 | 0 | 0 | 0 | 3 | 0 | 3 | 3 |\n| Haemaphysalis sp. genotype 2c | – | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 1 |\n| Ixodes cornuatus | Southern paralysis tick | 4 | 0 | 0 | 0 | 0 | 0 | 4 | 4 |\n| Ixodes hirsti | Hirstʼs marsupial tick | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 |\n| Ixodes holocyclus | Eastern paralysis tick | 188 | 19 | 124 | 28 | 22 | 12 | 334 | 393 |\n| Ixodes myrmecobii | – | 4 | 0 | 1 | 0 | 0 | 0 | 5 | 5 |\n| Ixodes tasmani | Common marsupial tick | 48 | 1 | 9 | 0 | 1 | 0 | 58 | 59 |\n| Ixodes trichosurid | Possum tick | 2 | 0 | 1 | 0 | 0 | 0 | 3 | 3 |\n| Rhipicephalus australis | Australian cattle tick | 1 | 0 | 0 | 0 | 2 | 0 | 3 | 3 |\n| Rhipicephalus sanguineus (s.l.) | Brown dog tick | 174 | 0 | 0 | 0 | 0 | 0 | 174 | 174 |\n| Grand total |  | 473 | 20 | 137 | 28 | 45 | 12 | 655 | 715 |\n\n\n| Target gene Target organism | Primer name | Primer sequence (50-30 ) | Expected amplicon length (bp) | Tann (􀀂 C) | Reference |\n| --- | --- | --- | --- | --- | --- |\n| 16S NGS\u003Cbr>16S Bacteria (V1-2) | 27F–Y | AGAGTTTGATCCTGGCTYAG | 300 | 58 | Gofton et al. (2015b) |\n| “Ca. Midichloria spp.” | 338R\u003Cbr>MidBlocker | GGATCACTCGATCGGTAGGAG TGCTGCCTCCCGTAGGAGT | na | 62 | Turner et al. (1999)\u003Cbr>Gofton et al. (2015b) |\n| Rickettsia-specific NGS\u003Cbr>17 kDa Rickettsia spp. | Rr17kDa1a\u003Cbr>Rr17kDa2a | GCTCTTGCAACTTCTATGTT CATTGTTCGTCAGGTTGGCG | 435 | 57 | Williams et al. (1992) |\n| gltA Rickettsia spp. | RpCS.877\u003Cbr>RpCS.1258n | GGGGGCCTGCTCACGGCGGATTGCAAAAAGTACAGTGAACA | 380 | 48 | Regnery et al. (1991) |\n| ompA SFGR | Rr190.70p\u003Cbr>Rr190.602n | ATGGCGAATATTTCTCCAAAAAGTGCAGCATTCGCTCCCCCT | 530 | 48 | Regnery et al. (1991) |\n| ompB Rickettsia spp. | 120-M59 ompBr | CCGCAGGGTTGGTAACTGC GAGGAGCTTTTTGAGTTGTAG | 555 | 50 | Roux and Raoult (2000) Owen (2007) |\n| PCR assays targeting bacterial taxa\u003Cbr>IS1111a Coxiella burnetii | IS1111aF\u003Cbr>IS1111aR\u003Cbr>IS1111aPb | GTTTCATCCGCGGTGTTAAT TGCAAGAATACGGACTCACGCCCACCGCTTCGCTCGCTAA | na | 64 | Banazis et al. (2010) |\n| 16S Coxiella spp. | QR-F0\u003Cbr>QR-R0 | ATTGAAGAGTTTGATTCTGGCGGCCTCCCGAAGGTTAG | 1,450 | 48 | Masuzawa et al. (1997) |\n| Francisella spp. | Fr153F0.1\u003Cbr>Fr1281R0.1 | GCCCATTTGAGGGGGATACCGGACTAAGAGTACCTTTTTGAGT | 1,170 | 60 | Barns et al. (2005) |\n| Legionellales sp.d | 8F\u003Cbr>1492R | AGAGTTTGATCCTGGCTCAG GGTTACCTTGTTACGACTT | 1,400–1,500 | 54 | Edwards et al. (1989)\u003Cbr>Stackebrandt and Liesack (1993) |\n| “Ca. Neoehrlichia spp.” | EC12AEC9 A17a IS58-1345r | TGATCCTGGCTCAGAACGAACGTACCTTGTTACGACTT GCGGCAAGCCTAACACATCACCAGCTTCGAGTTAAACC | 1,460\u003Cbr>1,265 | 48c\u003Cbr>54c | Paddock et al. (1997)\u003Cbr>Anderson et al. (1991)\u003Cbr>Kawahara et al. (2004) |\n| PCR assays targeting tick taxa\u003Cbr>cox1 Haemaphysalis spp.e | cox1F\u003Cbr>cox1R | GGAACAATATATTTAATTTTTGG ATCTATCCCTACTGTAAATATATG | 750 | 55 | Chitimia et al. (2010) |\n| Ixodes trichosuri | HCO2064\u003Cbr>HCO1240 | GGTGGGCTCATACAATAAATCCCCACAAATCATAAAGACATTGG | 850 | 48 | Song et al. (2011) |\n\n\n| Sequence statistic | Raw (unprocessed) reads | Pre-processed\u003Cbr>a\u003Cbr>sequences | Processed 16S sequencesb |  |  |  |  |\n| --- | --- | --- | --- | --- | --- | --- | --- |\n|  | Grand total (n ¼ 818) |  | Tick S and R (n ¼ 715) | ExCs (S, n ¼ 24, S and R, n ¼ 73) | NTCs (n ¼ 25) | ICs\u003Cbr>(n ¼ 5) | Grand total\u003Cbr>(n ¼ 818) |\n| Average | 64,949 | 43,093 | 42,460 | 27,728 | 27,860 | 35 | 39,965 |\n| SD | 48,248 | 31,379 | 30,235 | 22,661 | 49,408 | 16 | 17,728 |\n| Minimum | 40 | 6 | 381 | 7 | 5 | 10 | 5 |\n| ","cbCainoP65m5II8s","https://ap.wps.com/l/cbCainoP65m5II8s","pdf",5292000,23,"English","[{\"question\":\"Which molecular targets are included for bacterial detection in the document?\",\"answer\":\"The document lists targets such as 16S (bacteria V1–2), Rickettsia-specific markers (17 kDa, gltA, ompA, ompB), and other bacterial taxa using designated primers.\"},{\"question\":\"How are sequencing results summarized across samples?\",\"answer\":\"Sequencing outcomes are presented as raw (unprocessed) reads, pre-processed reads, processed 16S sequences, and processed Rickettsia-specific sequences, with averages, SD, min/max values, and total counts.\"},{\"question\":\"How does the document report dominant sequence variants for tick species?\",\"answer\":\"For selected tick species, it reports dominant ZOTUs with GenBank IDs, average sequence composition percentages with SD, and the range of composition across samples.\"}]","Rickettsia | PDF",8]