[{"data":1,"prerenderedAt":-1},["ShallowReactive",2],{"doc-seo-194713-105":3,"detail-sidebar-cat-1-en-105":81,"doc-detail-194713-en":126},{"code":4,"msg":5,"data":6},0,"ok",{"site_id":7,"language":8,"slug":9,"title":10,"keywords":11,"description":12,"schema_data":13,"social_meta":74,"head_meta":76,"extra_data":78,"updated_unix":80},105,"en","gene-reference-selection-and-qpcr-primer-and-stability-data","Gene Reference Selection and qPCR Primer and Stability Data","","Gene annotation and function are provided for multiple loci (e.g., TAO, RAP1, YTH3, PAN3, PP12A, PP43, TFIIF, GAPDH, CYCT1, SYN1A) together with primary references. Primer sequences are listed for each target gene with associated annealing temperatures, amplicon lengths, average Ct values, amplification efficiency, and R2. Reference-gene stability is evaluated using multiple algorithms (1Ct, BestKeeper, NormFinder, GeNorm, RefFinder) with ranking and stability metrics to identify the most stable candidates.",{"@graph":14,"@context":73},[15,34,56],{"@type":16,"itemListElement":17},"BreadcrumbList",[18,23,27,31],{"item":19,"name":20,"@type":21,"position":22},"https://docshare.wps.com","Home","ListItem",1,{"item":24,"name":25,"@type":21,"position":26},"https://docshare.wps.com/template/","Template",2,{"item":28,"name":29,"@type":21,"position":30},"https://docshare.wps.com/template/general/","General",3,{"item":32,"name":10,"@type":21,"position":33},"https://docshare.wps.com/template/gene-reference-selection-and-qpcr-primer-and-stability-data/194713/",4,{"url":32,"name":10,"@type":35,"image":36,"author":41,"headline":10,"publisher":44,"fileFormat":47,"inLanguage":8,"description":12,"dateModified":48,"datePublished":49,"encodingFormat":47,"isAccessibleForFree":50,"interactionStatistic":51},"DigitalDocument",{"url":37,"@type":38,"width":39,"height":40},"https://docshare.wps.com/thumbnails/gene-reference-selection-and-qpcr-primer-and-stability-data/194713.png","ImageObject",442,249,{"name":42,"@type":43},"eBook King","Person",{"url":19,"name":45,"@type":46},"DocShare","Organization","application/pdf","2026-09-30","2026-09-03",true,{"@type":52,"interactionType":53,"userInteractionCount":55},"InteractionCounter",{"@type":54},"ViewAction",5,{"@type":57,"mainEntity":58},"FAQPage",[59,65,69],{"name":60,"@type":61,"acceptedAnswer":62},"Which genes are included with their annotation and function in the document?","Question",{"text":63,"@type":64},"The document lists multiple loci and gene annotations, including TAO, RAP1, YTH3, PAN3, KIAA1109 homolog (KIAA), CYCT1, PP12A, PP43, TFIIF, GAPDH, and SYN1A. Each entry describes molecular roles such as signaling, transcription regulation, mRNA processing, or synaptic functions.","Answer",{"name":66,"@type":61,"acceptedAnswer":67},"What qPCR primer information is provided for each gene?",{"text":68,"@type":64},"For each gene, the document provides forward (FW) and reverse (REV) primer sequences, annealing temperatures (Tm), amplicon lengths in base pairs, average Ct values, amplification efficiency (%), and R2 values.",{"name":70,"@type":61,"acceptedAnswer":71},"How is reference-gene stability determined and compared?",{"text":72,"@type":64},"Reference-gene stability is assessed using multiple methods including 1Ct, BestKeeper, NormFinder, GeNorm, and RefFinder. Each method reports stability-related values and rankings so the most stable genes can be identified across algorithms.","https://schema.org",{"og:url":32,"og:type":75,"og:title":10,"og:site_name":45,"og:description":12},"article",{"robots":77,"canonical":32},"index,follow",{"doc_id":79,"site_id":7},194713,1790473064,{"code":4,"msg":82,"data":83},"success",[84,89,94,99,104,109,114,119,123],{"id":85,"doc_module":22,"doc_module_name":25,"category_name":86,"show_sort_weight":87,"slug":88},11,"Presentations",90,"presentations",{"id":90,"doc_module":22,"doc_module_name":25,"category_name":91,"show_sort_weight":92,"slug":93},12,"Resumes",80,"resumes",{"id":95,"doc_module":22,"doc_module_name":25,"category_name":96,"show_sort_weight":97,"slug":98},14,"Invoices",70,"invoices",{"id":100,"doc_module":22,"doc_module_name":25,"category_name":101,"show_sort_weight":102,"slug":103},15,"Posters",60,"posters",{"id":105,"doc_module":22,"doc_module_name":25,"category_name":106,"show_sort_weight":107,"slug":108},16,"Social Media",50,"social-media",{"id":110,"doc_module":22,"doc_module_name":25,"category_name":111,"show_sort_weight":112,"slug":113},17,"Forms",40,"forms",{"id":115,"doc_module":22,"doc_module_name":25,"category_name":116,"show_sort_weight":117,"slug":118},18,"Letters",30,"letters",{"id":120,"doc_module":22,"doc_module_name":25,"category_name":121,"show_sort_weight":55,"slug":122},21,"Paper Templates","papers-templates",{"id":124,"doc_module":22,"doc_module_name":25,"category_name":29,"show_sort_weight":4,"slug":125},158,"general-158",{"code":4,"msg":82,"data":127},{"doc_id":79,"user_id":128,"nickname":42,"user_avatar":129,"doc_module":22,"category_id":124,"category_name":29,"doc_title":10,"doc_description":12,"doc_content":130,"file_id":131,"file_url":132,"file_type":133,"file_size":134,"view_count":30,"is_deleted":4,"is_public":22,"is_downloadable":22,"audit_status":22,"page_count":85,"language":135,"language_code":8,"site_id":7,"html_lang":8,"table_of_contents":136,"faqs":137,"seo_title":138,"seo_description":12,"update_tm":139,"read_time":33},962088006270,"https://ap-avatar.wpscdn.com/davatar_085a072bc5b1113ac321206ff7593b45","| Accession name | Gene ID | Gene annotation | Gene function | References |\n| --- | --- | --- | --- | --- |\n| LOC115875935 | TAO | Serine/threonine-protein kinase Tao | G-protein signaling cascade, regulates DNA damage response, apoptosis and cytoskeleton | Hutchison et al., 1998; Timmet al., 2006 |\n| LOC115876598 | RAP1 | Ras-related protein Rap1 | Small GTPase, regulates cell adhesion, cell junction formation, and integrin-mediated signaling | Caron, 2003 |\n| LOC115877543 | YTH3 | YTH domain-containing family protein 3 | Transcriptional regulator involved in the degradation of N6-methyladenosine (m6A)-containing mRNA and non-coding RNAs | Zaccara and\u003Cbr>Jaffrey, 2020 |\n| LOC115882250 | PAN3 | PAN (Poly-A Nuclease)2-PAN3 deadenylation complex subunit Pan3 | Transcriptional regulator, part ofa poly-A degradation complex | Brown et al., 1996; Garneau et al., 2007 |\n| LOC115883196 | KIAA | Transmembrane protein KIAA1109 homolog | Synaptic development and function, regulation of regulating synaptic plasticity | Kursula, 2014 |\n| LOC115889772 | CYCT1 | Cyclin-T1 | Subunit of the positive transcription elongation factor b (P-TEFb), promotes RNA polymerase II transcription elongation | Shim et al., 2002 |\n| LOC115890036 | PP12A | Protein phosphatase 1 regulatory subunit 12A | Subunit of the myosin phosphatase complex responsible for the interaction between actin and myosin | Takahashi et al., 1997; Hughes et al., 2020 |\n| LOC115890441 | PP43 | Serine/threonine-protein phosphatase 4 regulatory subunit 3 | Ser/Thr phosphatase conserved in yeasts, mammals, insects, plants | Gingras et al.,\u003Cbr>2005; Kataya et al., 2017; Karman et al., 2020 |\n| LOC115891122 | TFIIF | General transcription factor IIF subunit 1 | Transcription initiation factor, part of the pre-initiation complex | Aso et al., 1992; Luse, 2012 |\n| LOC115881082 | GAPDH | Glyceraldehyde 3-phosphate dehydrogenase | Glycolysis, gene regulation and DNA repair | Sirover, 1999 |\n| LOC115890765 | SYN1A | Syntaxin-1 | Intracellular vesicle traffic, synaptic vesicle fusion | Zhou et al., 2000 |\n\n| Gene name | Locus | Primer sequences (FW and REV) | Tm FW/REV (􀀎 C) | Amplicon length (bp) | Average Ct | Efficiency\u003Cbr>(%) | R2 |\n| --- | --- | --- | --- | --- | --- | --- | --- |\n| CYCT1 | LOC115889772 | CAGGACATGGGGCAAAGACTA | 59.72 | 102 | 25.66 | 96.5 | 1 |\n|  |  | TGGGAAGTCAGTGAAGGAGTG | 59.31 |  |  |  |  |\n| KIAA | LOC115883196 | CCGCATCATTGCGGGTAAAA | 59.55 | 100 | 38.01 | 61.6 | 0.999 |\n|  |  | GAACTAGCGCTGGGTAACGA | 59.83 |  |  |  |  |\n| PAN3 | LOC115882250 | AGTTGACAGTTACCACGAGCTT | 59.90 | 91 | 26.03 | 91.3 | 1 |\n|  |  | GTACATGGAGGCCTGATAGCC | 60.00 |  |  |  |  |\n| PP12A | LOC115890036 | TGCTCAAGGACGAGATTCGG | 59.83 | 97 | 24.00 | 96.2 | 0.999 |\n|  |  | GCCAACCATTCTTTGGCGTC | 60.39 |  |  |  |  |\n| PP43 | LOC115890441 | GCGCCGGATATTGGTTCTGA | 60.53 | 89 | 24.23 | 95.5 | 1 |\n|  |  | CCTTGAGGGCGACCAGTTT | 59.93 |  |  |  |  |\n| RAP1 | LOC115876598 | CGGCATCGCCCGATACAA | 60.28 | 107 | 32.57 | 78.4 | 1 |\n|  |  | CCCCCTGACCCAAGTACTACA | 60.95 |  |  |  |  |\n| SYNT1 | LOC115890765 | ACAGGGAGAGGTGTAAAGCG | 59.39 | 109 | 27.60 | 94.4 | 1 |\n|  |  | AAGACGGTAGAAGTTCCTTGTTCT | 59.66 |  |  |  |  |\n| TAO | LOC115875935 | CGGTTCATTCTGTTGGGGTGT | 60.82 | 94 | 24.09 | 94.4 | 1 |\n|  |  | TTCGTTGTTCCATCCTCGCC | 60.67 |  |  |  |  |\n| TFIIF | LOC115891122 | GACCCGATGATCAGCCTTGG | 60.53 | 92 | 24.67 | 97.1 | 1 |\n|  |  | TGTGTTTTCTGAGACACCCCC | 60.13 |  |  |  |  |\n| YTH3 | LOC115877543 | GAATTCAGCAGCTCATCCAGC | 59.67 | 101 | 24.82 | 91.2 | 1 |\n|  |  | ATGTTCCTCCACTGCCATAATAAC | 58.87 |  |  |  |  |\n| GAPDH | LOC115881082 | TGACCGTCAGGTTAGGCAAA | 59.24 | 94 | 20.03 | 96.9 | 1 |\n|  |  | TAGCCCAGGATGCCCTTCA | 60.31 |  |  |  |  |\n\n|  | 1Ct |  | BestKeeper |  | NormFinder |  | GeNorm |  | Reffinder |  |\n| --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- |\n| Rank | Gene name | Mean st.\u003Cbr>dev. | Gene name | R | Gene name | SV | Gene name | M | Gene name | GM |\n| 1 | TAO | 0.378 | SYN1A | 0.245 | TA","cbCaidzWMJUOMhXX","https://ap.wps.com/l/cbCaidzWMJUOMhXX","pdf",5049580,"English","# Primer sequences and target gene annotation\n## Gene functions and references\n## Primer sets with qPCR performance metrics\n# Reference gene stability assessment\n## 1Ct and BestKeeper rankings\n## NormFinder, GeNorm and RefFinder rankings","[{\"question\":\"Which genes are included with their annotation and function in the document?\",\"answer\":\"The document lists multiple loci and gene annotations, including TAO, RAP1, YTH3, PAN3, KIAA1109 homolog (KIAA), CYCT1, PP12A, PP43, TFIIF, GAPDH, and SYN1A. Each entry describes molecular roles such as signaling, transcription regulation, mRNA processing, or synaptic functions.\"},{\"question\":\"What qPCR primer information is provided for each gene?\",\"answer\":\"For each gene, the document provides forward (FW) and reverse (REV) primer sequences, annealing temperatures (Tm), amplicon lengths in base pairs, average Ct values, amplification efficiency (%), and R2 values.\"},{\"question\":\"How is reference-gene stability determined and compared?\",\"answer\":\"Reference-gene stability is assessed using multiple methods including 1Ct, BestKeeper, NormFinder, GeNorm, and RefFinder. Each method reports stability-related values and rankings so the most stable genes can be identified across algorithms.\"}]","Gene Reference Selection and qPCR Primer and Stability Data | PDF",1788441895]