[{"data":1,"prerenderedAt":-1},["ShallowReactive",2],{"doc-seo-190810-105":3,"detail-sidebar-cat-1-en-105":81,"doc-detail-190810-en":126},{"code":4,"msg":5,"data":6},0,"ok",{"site_id":7,"language":8,"slug":9,"title":10,"keywords":11,"description":12,"schema_data":13,"social_meta":74,"head_meta":76,"extra_data":78,"updated_unix":80},105,"en","effects-of-bd-and-hp-treatments-on-nutritional-composition-gene-expression-and-growth-performance","Effects of BD and HP Treatments on Nutritional Composition, Gene Expression, and Growth Performance","","Diet formulations with varying BD (BD50, BD100) and HP (HP50, HP100) treatments were evaluated through proximate composition, amino acid profiles, feed ingredient compositions, and additional biochemical and histological score measures. Nutrient parameters including protein, moisture, fat, fiber, ash, phosphorus, taurine, and hydroxyproline were quantified alongside gene expression forward/reverse sequences for selected markers (e.g., actb, il-1b, apn, mga, atpase, gpx1). Growth and performance outcomes were compared using final weight, percent weight gain, FCR, PRE, survival, and statistical P-values across treatments.",{"@graph":14,"@context":73},[15,34,56],{"@type":16,"itemListElement":17},"BreadcrumbList",[18,23,27,31],{"item":19,"name":20,"@type":21,"position":22},"https://docshare.wps.com","Home","ListItem",1,{"item":24,"name":25,"@type":21,"position":26},"https://docshare.wps.com/template/","Template",2,{"item":28,"name":29,"@type":21,"position":30},"https://docshare.wps.com/template/general/","General",3,{"item":32,"name":10,"@type":21,"position":33},"https://docshare.wps.com/template/effects-of-bd-and-hp-treatments-on-nutritional-composition-gene-expression-and-growth-performance/190810/",4,{"url":32,"name":10,"@type":35,"image":36,"author":41,"headline":10,"publisher":44,"fileFormat":47,"inLanguage":8,"description":12,"dateModified":48,"datePublished":49,"encodingFormat":47,"isAccessibleForFree":50,"interactionStatistic":51},"DigitalDocument",{"url":37,"@type":38,"width":39,"height":40},"https://docshare.wps.com/thumbnails/effects-of-bd-and-hp-treatments-on-nutritional-composition-gene-expression-and-growth-performance/190810.png","ImageObject",442,249,{"name":42,"@type":43},"Rowan","Person",{"url":19,"name":45,"@type":46},"DocShare","Organization","application/pdf","2026-10-03","2026-09-03",true,{"@type":52,"interactionType":53,"userInteractionCount":55},"InteractionCounter",{"@type":54},"ViewAction",5,{"@type":57,"mainEntity":58},"FAQPage",[59,65,69],{"name":60,"@type":61,"acceptedAnswer":62},"Which treatment groups were compared in the study?","Question",{"text":63,"@type":64},"Treatments included a Basal group and diet variants BD50, BD100, HP50, HP100, plus a Reference group.","Answer",{"name":66,"@type":61,"acceptedAnswer":67},"What nutritional composition endpoints were reported?",{"text":68,"@type":64},"Proximate composition metrics such as crude protein, moisture, crude fat, crude fiber, ash, and phosphorus were reported, along with specific amino acids and compounds like taurine and hydroxyproline.",{"name":70,"@type":61,"acceptedAnswer":71},"How were growth and performance evaluated across treatments?",{"text":72,"@type":64},"Growth was assessed using final weight, percent weight gain, FCR, PRE (%), and survival (%), with corresponding P-values to compare differences between diets.","https://schema.org",{"og:url":32,"og:type":75,"og:title":10,"og:site_name":45,"og:description":12},"article",{"robots":77,"canonical":32},"index,follow",{"doc_id":79,"site_id":7},190810,1788405071,{"code":4,"msg":82,"data":83},"success",[84,89,94,99,104,109,114,119,123],{"id":85,"doc_module":22,"doc_module_name":25,"category_name":86,"show_sort_weight":87,"slug":88},11,"Presentations",90,"presentations",{"id":90,"doc_module":22,"doc_module_name":25,"category_name":91,"show_sort_weight":92,"slug":93},12,"Resumes",80,"resumes",{"id":95,"doc_module":22,"doc_module_name":25,"category_name":96,"show_sort_weight":97,"slug":98},14,"Invoices",70,"invoices",{"id":100,"doc_module":22,"doc_module_name":25,"category_name":101,"show_sort_weight":102,"slug":103},15,"Posters",60,"posters",{"id":105,"doc_module":22,"doc_module_name":25,"category_name":106,"show_sort_weight":107,"slug":108},16,"Social Media",50,"social-media",{"id":110,"doc_module":22,"doc_module_name":25,"category_name":111,"show_sort_weight":112,"slug":113},17,"Forms",40,"forms",{"id":115,"doc_module":22,"doc_module_name":25,"category_name":116,"show_sort_weight":117,"slug":118},18,"Letters",30,"letters",{"id":120,"doc_module":22,"doc_module_name":25,"category_name":121,"show_sort_weight":55,"slug":122},21,"Paper Templates","papers-templates",{"id":124,"doc_module":22,"doc_module_name":25,"category_name":29,"show_sort_weight":4,"slug":125},158,"general-158",{"code":4,"msg":82,"data":127},{"doc_id":79,"user_id":128,"nickname":42,"user_avatar":129,"doc_module":22,"category_id":124,"category_name":29,"doc_title":10,"doc_description":12,"doc_content":130,"file_id":131,"file_url":132,"file_type":133,"file_size":134,"view_count":55,"is_deleted":4,"is_public":22,"is_downloadable":22,"audit_status":22,"page_count":105,"language":135,"language_code":8,"site_id":7,"html_lang":8,"table_of_contents":136,"faqs":137,"seo_title":138,"seo_description":12,"update_tm":80,"read_time":139},1099514067415,"https://ap-avatar.wpscdn.com/avatar/100002539d78ffe74a7?x-image-process=image/resize,m_fixed,w_180,h_180&k=1779092875211072502","|  | Treatments |  |  |  |  |  |\n| --- | --- | --- | --- | --- | --- | --- |\n| Proximate composition (g 100g-1) | Basal | BD50 | BD100 | HP50 | HP100 | Reference |\n| Crude protein | 45.79 | 46.54 | 44.88 | 46.84 | 43.85 | 44.43 |\n| Moisture | 7.17 | 6.34 | 9.38 | 5.1 | 10.49 | 9.39 |\n| Crude Fat | 9.62 | 9.56 | 9.21 | 9.64 | 8.81 | 8.73 |\n| Crude Fiber | 2.25 | 2.02 | 1.94 | 2.21 | 2.42 | 1.24 |\n| Ash | 8.59 | 8.57 | 8.09 | 8.62 | 8.03 | 8.64 |\n| Phosphorus | 1.46 | 1.49 | 1.38 | 1.59 | 1.38 | 1.41 |\n| Taurine § | 0.8 | 0.81 | 0.79 | 0.79 | 0.77 | 0.97 |\n| Hydroxyproline | 0.45 | 0.48 | 0.44 | 0.52 | 0.46 | 0.69 |\n| Aspartic Acid | 3.91 | 3.91 | 3.79 | 3.88 | 3.78 | 3.32 |\n| Threonine | 1.65 | 1.65 | 1.59 | 1.65 | 1.61 | 1.57 |\n| Serine | 1.79 | 1.78 | 1.74 | 1.81 | 1.74 | 1.58 |\n| Glutamic Acid | 7.68 | 7.73 | 7.55 | 7.76 | 7.32 | 6.5 |\n| Proline | 3.02 | 2.99 | 2.88 | 3.01 | 2.82 | 2.75 |\n| Lanthionine § | 0.05 | 0.06 | 0.06 | 0.06 | 0.06 | 0.04 |\n| Glycine | 2.52 | 2.59 | 2.46 | 2.62 | 2.48 | 2.94 |\n| Alanine | 2.59 | 2.61 | 2.5 | 2.63 | 2.46 | 2.7 |\n| Cysteine | 0.63 | 0.61 | 0.57 | 0.6 | 0.58 | 0.5 |\n| Valine | 2.16 | 2.15 | 2.07 | 2.17 | 2.06 | 1.98 |\n| Methionine | 1.01 | 1 | 0.96 | 1.03 | 0.97 | 0.98 |\n| Isoleucine | 1.99 | 1.97 | 1.91 | 1.99 | 1.89 | 1.73 |\n| Leucine | 3.95 | 3.95 | 3.84 | 4 | 3.74 | 3.55 |\n| Tyrosine | 1.64 | 1.64 | 1.59 | 1.64 | 1.57 | 1.39 |\n| Phenylalanine | 2.17 | 2.16 | 2.12 | 2.2 | 2.08 | 1.85 |\n| Hydroxylysine | 0.06 | 0.06 | 0.06 | 0.06 | 0.06 | 0.09 |\n| Ornithine § | 0.03 | 0.04 | 0.03 | 0.04 | 0.04 | 0.04 |\n| Lysine | 2.47 | 2.45 | 2.37 | 2.43 | 2.3 | 2.49 |\n| Histidine | 1.05 | 1.05 | 1.02 | 1.05 | 0.99 | 0.97 |\n| Arginine | 2.67 | 2.71 | 2.63 | 2.71 | 2.61 | 2.39 |\n| Tryptophan | 0.45 | 0.44 | 0.42 | 0.44 | 0.42 | 0.38 |\n| Total | 44.74 | 44.84 | 43.39 | 45.09 | 42.81 | 41.4 |\n\n\n|  | Basal | BD50 | BD100 | HP50 | HP100 | Reference |\n| --- | --- | --- | --- | --- | --- | --- |\n| Menhaden fishmeal 1 | 100.0 | 100.0 | 100.0 | 100.0 | 100.0 | 300.0 |\n| Poultry meal 2 | 200.0 | 200.0 | 200.0 | 200.0 | 200.0 | 238.0 |\n| SE Soybean meal 3 | 344.0 | 172.0 |  | 172.0 |  |  |\n| SBM Bright Day 4 |  | 144.0 | 289.0 |  |  |  |\n| SBM HP 300 5 |  |  |  | 139.0 | 279.0 |  |\n| Corn protein concentrate 6 | 80.0 | 80.0 | 80.0 | 80.0 | 80.0 | 80.0 |\n| Menhaden fish oil 7 | 60.7 | 61.1 | 61.6 | 59.3 | 57.8 | 38.7 |\n| Corn Starch 8 | 0.4 | 26.0 | 52.5 | 32.8 | 66.3 | 152.8 |\n| Whole wheat 9 | 173.0 | 175.0 | 175.0 | 175.0 | 175.0 | 175.0 |\n| Mineral premix 10 | 2.5 | 2.5 | 2.5 | 2.5 | 2.5 | 2.5 |\n| Vitamin premix 11 | 5.0 | 5.0 | 5.0 | 5.0 | 5.0 | 5.0 |\n| Choline chloride 8 | 2.0 | 2.0 | 2.0 | 2.0 | 2.0 | 2.0 |\n| Rovimix Stay-C 35% 12 | 1.0 | 1.0 | 1.0 | 1.0 | 1.0 | 1.0 |\n| CaP-dibasic 8 | 25.0 | 25.0 | 25.0 | 25.0 | 25.0 | 0.0 |\n| Methionine 13 | 1.4 | 1.4 | 1.4 | 1.4 | 1.4 | 0.0 |\n| Taurine 13 | 5.0 | 5.0 | 5.0 | 5.0 | 5.0 | 5.0 |\n\n\n| Score | Appearance |\n| --- | --- |\n|  | Lamina propria of simple folds |\n| 1 | Thin and delicate core of connective tissue in all simple folds |\n| 2 | Lamina propria is slightly more distinct and robust in some of the folds |\n| 3 | Clear increase in lamina propria in most of the simple folds |\n| 4 | Thick lamina propria in many folds |\n|  | Connective tissue between the base offolds and stratum compactum |\n| 1 | Very thin layer of connective tissue between base offolds and stratum compactum |\n| 2 | Slightly increased amount of connective tissue beneath some of the mucosal folds |\n| 3 | Clear increase of connective tissue beneath most ofthe mucosal folds |\n| 4 | Thick layer of connective tissue beneath many folds |\n|  | Vacuoles |\n| 1 | Large vacuoles are absent |\n| 2 | Very few large vacuoles are present |\n| 3 | Large vacuoles are numerous |\n| 4 | Large vacuoles are abundant in present in most epithelial cells |\n\n\n|  | Forward Sequence | Reverse Sequence | E (%) | R2 |\n| --- | --- | --- | --- | --- |\n| actb | TGCGTGACATCAAGGAGAAG | AGGAAGGAAGGCTGGAAGAG | 96.8 | 0.99 |\n| il-1b |","cbCaiqvV0yJcgwoH","https://ap.wps.com/l/cbCaiqvV0yJcgwoH","pdf",1171135,"English","# Nutritional composition by treatment\n## Proximate composition and minerals\n## Amino acid composition\n# Feed formulation composition\n## Ingredient inclusion levels\n# Histology and scoring metrics\n## Lamina propria and connective tissue scores\n## Vacuole scoring\n# Gene expression assay\n## Forward and reverse sequences with efficiency\n# Growth and performance outcomes\n## Final weight, weight gain, FCR, PRE, survival\n## Statistical significance (P-value)","[{\"question\":\"Which treatment groups were compared in the study?\",\"answer\":\"Treatments included a Basal group and diet variants BD50, BD100, HP50, HP100, plus a Reference group.\"},{\"question\":\"What nutritional composition endpoints were reported?\",\"answer\":\"Proximate composition metrics such as crude protein, moisture, crude fat, crude fiber, ash, and phosphorus were reported, along with specific amino acids and compounds like taurine and hydroxyproline.\"},{\"question\":\"How were growth and performance evaluated across treatments?\",\"answer\":\"Growth was assessed using final weight, percent weight gain, FCR, PRE (%), and survival (%), with corresponding P-values to compare differences between diets.\"}]","Effects of BD and HP Treatments on Nutritional Composition, Gene Expression, and Growth Performance | PDF",6]